Page 43 - Read Online
P. 43

Nakamoto et al. Plast Aesthet Res 2024;11:54  https://dx.doi.org/10.20517/2347-9264.2024.82  Page 7 of 14

               Table 1. Primer sequences used for RT-qPCR assays
                                            Used pair 1
                shEEF1A1-qF                 GGCACGTAGATTCAGGGAAG
                shEEF1A1-qR                 CCCAGGCATATTTGAAGGAG

                shKRT1-qF                   CTTCTGCAACCCCTCAATGT
                shKRT1-qR                   GTTCTGCTGCTCCAGGAATC
                shKRT10-qF                  GGTAATTCAAGCCAGCGAGA
                shKRT10-qR                  CAGCCTGGCATTATCAACCT
                shPCNA-qF                   CTTGGTGCAGCTAACCCTTC
                shPCNA-qR                   ATGTCTTCATTGCCAGCACA

                shTGFb1-qF                  GGGTACCACGCCAATTTCT
                shTGFb1-qR                  GGTTGTGCTGGTTGTACAGG
                shTGFBR1-qF                 CAACCAGGACCACTGCAATA
                shTGFBR1-qR                 AAGCAGACTGGTCCAGCAAT
                shTGFBR2-qF                 CCCTGTCGGTAGATGACCTG
                shTGFBR2-qR                 CAGGGCCATGGAGTAGACAT
                shVim-qF                    CTTCAGGAGGCTGAGGAATG
                shVim-qR                    GTTGTTGCGGTTAGCAGCTT
                shFN1-qF                    CTCGAAGAGCAGGAGACAGG
                shFN1-qR                    CGCTCCCACTGTTGGTTTAT
                shCol1a1-qF                 CAGGAAGAAGGCCAAGAAGA
                shCol1a1-qR                 CACACGTCTCGGTCATGGTA
                shActa2-qF                  AGCTATGAGCTGCCTGATGG
                shActa2-qR                  GTACGTGGTCTCATGGATGC
                shCol3a1-qF                 GGTGGACAGATTCTGGTGCT
                shCol3a1-qR                 GGACATCTTCGGGAAGTTCA
                shMMP1-qF                   AAATCCTCGTTGGGAGAACA
                shMMP1-qR                   TTGGTCCACATCTGCTCTTG

               RT-qPCR: Reverse transcription and quantitative polymerase chain reaction.

               healing-associated target transcripts between the treatment and control groups [Figure 10]. PCNA was used
               as a biomarker to measure any differences in cell proliferation. KRT1, KRT10, COL1A1, COL3A1, ACTA2,
               and MMP1 were used as biomarkers for myofibroblast activation (MFA). VIM and FN1 were used as
               biomarkers for epithelial-mesenchymal transition (EMT). TGF1, TGFR1, and TGFR2 were used for TGF-
               associated pathways. These results indicate that timolol does not affect cell proliferation, at least at the
               transcriptional level.

               DISCUSSION
               This study demonstrates that the topical application of timolol accelerates the epithelialization of mesh skin
               grafted full-thickness burn wounds in sheep. Furthermore, the histology results showed that epidermal
               thickness was significantly higher in the treated group. Our results also indicate that the treatment with
               timolol did not affect the wound blood flow, suggesting that the beneficial effects of beta-blockers are not
               attributable to wound blood flow improvement. In addition, the histology result showed that the number of
               blood vessels in the wound was comparable. Although the exact reason is unknown, we speculate that beta-
               blockers may not promote neovascularization. If the hypothesis is correct, this suggests that combined use
   38   39   40   41   42   43   44   45   46   47   48