Page 325 - Read Online
P. 325
Liu et al. Adipogenesis of obital fat stem cells
(CFU-F, a cluster of at least 20 adherent, fibroblast-like transcribed to cDNA using Oligo dT primers and the
cells) was counted on the 7th day in primary culture. final cDNA was subjected to real time PCR (7300
Upon reaching approximately 80-90% confluence, the Real-Time PCR System, Applied Biosystems, Foster
cells were detached with 0.05% trypsin/0.5 mmol/L EDTA City, CA, USA). Fold changes in gene expression level
(Sigma), seeded into 6-well culture plates (Falcon) were calculated by the 2 -∆∆Ct method and the results
2
at a density of 5,000 cells/cm , and subcultured as were normalized to the expression of an internal
first-passaged cells (P1). OASCs were passaged control, β-actin. The PCR primer sequences were
similarly for a total of 9 passages, and the proliferative listed as followed, with primer specificity confirmed on
potential was determined by calculating the cumulative the NCBI Primer-BLAST website:
population doublings using the following formula: Human PPARγ F: 5’TCCTCGGAAATGGGACCCTC3’,
[log 10 (NH) - log 10 (NI)]/log 10 (2), where NI is the inoculum R: 5’ATCCACGGAGCTGATCCCAA3’.
cell number and NH is the cell harvest number. Once Human β-actin F: 5’CTGGAACGGTGAAGGTGACA3’,
the cells were unable to reach confluence or a doubling R: 5’AAGGGACTTCCTGTAACAATGCA3’.
time of over 100 h was obtained in two consecutive
passages before achieving the 9th passage, the culture Statistical analysis
was considered to have failed at that passage. [9] All data collected were presented as mean ± standard
deviation. One-way analysis of variance and the
Flow cytometry of OASCs Student-Newman-Keuls test were used to determine
The phenotypic characterization of OASCs was performed possible significant differences (P < 0.05) between
using a FACScan cytometer (Coulter Epics Altra, groups.
Becton Dickson, San Jose, CA, USA). Briefly, cells
of passage 2 (P2) were trypsinized and resuspended RESULTS
in the flow cytometry buffer (PBS containing 0.1%
FBS and 0.02% natrium azide). After blocked with Morphological observation
5
human immunoglobulin, cell aliquots (1 × 10 ) were Grossly observed, the central fat taken from the lower
incubated with the following fluorescein isothiocyanate lids in group A had fewer blood vessels and more
(FITC)-conjugated or phycoerythrin (PE)-conjugated fibrous tissue than that in group B. The average mass
monoclonal antibodies: CD14-FITC, CD19-FITC, of OF samples was (0.412 ± 0.189) g and (0.451
CD34-FITC, CD45-PE, CD73-PE, CD90-FITC and ± 0.211) g for the young and middle-aged groups,
CD105-FITC. Labeled cells were analyzed by flow respectively. No significant difference was observed
cytometry and non-specific IgG stained cells were used regarding the tissue mass between groups (P > 0.05).
as isotype controls (all antibodies from Santa Cruz Histologically, it was found that the septal membranes
Biotechnology, Dallas, TX, USA). separating the adipose lobules were denser in the
younger group, and that the adipocytes within fatty
Adipogenic differentiation of OASCs lobules were of similar sizes and arranged tightly. In the
When OASCs of passage 3 from both young and middle-aged group, the fat cells were arranged loosely
middle-aged groups reached near-confluence, and were of not uniform size [Figure 1]. Compared to
adipogenic differentiation was induced by replacing group A, the mean diameter, perimeter and area of OF
GM with the adipogenic medium (AM, consisting of GM adipocytes in group B showed significantly decreasing
plus 0.5 mmol/L isobutyl-methylxanthine, 10 mmol/L trends (P > 0.05, data not shown).
insulin, and 200 mmol/L indomethacin, all from Sigma).
AM was changed twice a week and the intracellular Cell yield and growth kinetics
lipid accumulation was assessed by oil red O staining The yield of viable cells isolated from OF was (0.75
6
(Sigma) after 14-day differentiation. For quantification ± 0.17) × 10 cells/g in group A and (0.68 ± 0.13) ×
measurement, the number of oil red O-positive-staining 10 cells/g in group B, with no significant difference
6
cells was displayed as the percentage of the total cells between the two groups (P > 0.05). In Group A, the
counted within the image. Cells cultured in GM for 2 cell colonies were detected as early as 48 h after
weeks served as controls. primary seeding and these cells proliferated rapidly. In
contrast, colonies usually formed after 72 h or more in
The mRNA level of adipogenesis-related gene, group B. When the CFU-F numbers were determined
peroxisome proliferator-activated receptor γ (PPARγ) on the 7th day in culture, more and bigger colonies
was quantified by real-time PCR assay. Briefly, after a were observed in group A than in group B (19.45 ±
2-week adipogenic-induction, total RNA was extracted 2.52 vs. 8.42 ± 1.37, P < 0.001) [Figure 2]. Passaged
from OASCs using the RNeasy Mini Kit (Qiagen, cells from both groups exhibited similar homogeneous
Valencia, CA, USA). RNA samples were reverse- fibroblast-like morphology, but the doubling time in
324 Plastic and Aesthetic Research ¦ Volume 3 ¦ October 25, 2016

