Page 100 - Read Online

Page 168 Muroy et al. Neuroimmunol Neuroinflammation 2020;7:166-82 I http://dx.doi.org/10.20517/2347-8659.2020.16

METHODS
Animals
Adult male C57Bl6/J mice were purchased from The Jackson Laboratory and maintained on a 12-h/12-h light/
dark cycle (lights on at 07:00) with ad libitum access to food and water and aged for ~2.5, ~14, or ~20 months.
All animal care and procedures were approved by the University of California, Berkeley Animal Care and Use
Committee.

shRNA-mediated knockdown of Phf15 in murine microglial cells
pGIPZ lentiviral mouse Phf15 shRNA constructs or a control scrambled shRNA were purchased from
Dharmacon (Lafayette, CO). Lentivirus was packaged via co-transfection of each pGIPZ shRNA with
[27]
[27]
pCMV-VSV-G (Addgene plasmid #8454) and pCMV-dR8.2 (Addgene plasmid #8455) into HEK 293T
cells using Lipofectamine 3000 reagent (Life Technologies, Carlsbad, CA) according to the manufacturer’s
instructions. Viral supernatant was harvested after 48 h and incubated with SIM-A9 murine microglial
cells in SIM-A9 complete medium [DMEM/F12 (Life Technologies, Carlsbad, CA), 10% fetal bovine
serum (FBS; GE Healthcare Life Sciences, Chicago, IL), 5% horse serum (HS; GE Healthcare Life Sciences,
Chicago, IL), and 1% Penicillin-Streptomycin (Life Technologies, Carlsbad, CA)]. After 48 h, GFP+ cells
were sorted by Fluorescence-activated cell sorting (FACS) on an Aria Fusion (BD Biosciences, San Jose,
CA; UC Berkeley Cancer Research Laboratory), expanded, and subcultured for immune stimulation
experiments. Percent knockdown (KD) was determined via real-time quantitative PCR (RT-qPCR).

Overexpression of Phf15 in murine microglial cells
A Phf15 overexpression (OE) vector was constructed by cloning the full length Phf15 cDNA (Mus musculus
PHD finger protein 15, mRNA cDNA clone MGC:143877 IMAGE:40094330) obtained from Dharmacon
(Lafayette, CO) into a pMYs-IRES-GFP retroviral vector (Cell Biolabs Inc., San Diego, CA). Viruses
expressing the full length Phf15 cDNA or empty vector control were co-transfected with pCL-10 A1
[28]
(Addgene plasmid #15805) in HEK 293T cells using Lipofectamine 3000 (Life Technologies, Carlsbad,
CA) reagent according to the manufacturer’s instructions. SIM-A9 cells were incubated with virus for
24 h and then sorted via FACS on an Aria Fusion, expanded, and subcultured for immune stimulation
experiments. Fold OE was verified via RT-qPCR.

Generation of Phf15 knockout microglia
Phf15 knockout (KO) SIM-A9 cells were generated using the Alt-R CRISPR-Cas9-mediated gene editing
system (guide RNA sequence ACTACATCCTGGCGGACCCGTGG) from IDT (Coralville, IA) using
CRISPRMAX Lipofectamine reagent (IDT) as per the manufacturer’s instructions. ATTO 550+ cells were
single-cell sorted on an Aria Fusion. Clones were screened for Phf15 deletion using PCR (primers Forward:
agcacacttgtaaccctcct and Reverse: gaccaatgtctgttgttgttcg) followed by restriction digest with BtgI (New
England Biolabs, Ipswich, MA). Percent decrease in Phf15 mRNA transcript expression was determined via
RT-qPCR. Primer sequences are listed in Supplementary Table 1.

Immune stimulation
For all immune stimulation time course experiments, cells (KD, KO, and OE, and respective controls)
6
were subcultured in 24-well plates at a density of 0.05 × 10 cells/well (in triplicate) and stimulated
with lipopolysaccharide (LPS; final concentration of 100 ng/mL; Sigma Aldrich, St. Louis, MO), CpG
oligodeoxynucleotide (CpG ODN; final concentration of 2.5 μmol/L; InvivoGen, San Diego, CA), or
polyinosinic:polycytidylic acid [Poly(I:C); final concentration of 25 μmol/L; Sigma Aldrich, St. Louis, MO]
for 1, 6, 12, or 24 h. No stimulation controls received an equivalent volume of sterile 1× PBS (Invitrogen,
Carlsbad, CA).