Page 105 - Read Online

including: drug resistance, nephrotoxicity, and myopathy. each indicated expression plasmid using PolyFect. After
[4]
Therefore, new drug strategies with other mechanisms are transfection, the cells were lysed in cell culture lysis
extensively required for antiviral therapy. buffer (Promega, Madison, WI, USA). Luciferase activity was
determined using an analytical luminescence luminometer
This study focused on the anti-viral effect of sorafenib based according to the manufacturer’s instructions. Luciferase
on the function of inhibiting the molecular signaling pathway. activity was normalized for transfection efficiency using
We investigated the effect of sorafenib on HBV replication the corresponding β-galactosidase activity. All assays were
using a human hepatoma cell line and a normal liver cell line performed at least in triplicate.
and confirmed that sorafenib suppressed HBV replication via
inhibiting the JNK pathway, which regulated the activity of Cell viability assay
the transcription factor, farnesoid X receptor (FXR). These Cell viability was determined by PrestoBlue cell viability
results suggest that HBV replication is associated with the reagent (Invitrogen, Carlsbad, CA, USA). Cells were treated
JNK pathway and may be regulated through inhibition of the with sorafenib at the indicated concentration for 24 h.
JNK pathway by sorafenib. The medium was removed and replaced with complete
cell culture medium containing PrestoBlue (×10) for 1 h.
METHODS After incubation with PrestoBlue, the medium was placed
into 96-well plate for analysis. Absorbance values were
Cell culture determined at 570 nm.
HepG2 and Chang liver cells (all obtained from the
American Type Culture Collection, Manassas, VA, USA) Reverse transcriptase-PCR and real-time PCR
were maintained in Dulbecco’s Modified Eagle Medium Total RNAs from cells were prepared using Trizol (Invitrogen)
with 10% fetal bovine serum (Gibco BRL, USA) and 1% (v ⁄ v) according to the manufacturer’s recommendation. The
penicillin-streptomycin (Gibco BRL, USA) at 37 °C in a humid cDNA was synthesized from 0.5 μg of total RNA with M-MLV
atmosphere containing 5% CO . reverse transcriptase (Promega) using oligo-dT at 37 °C for
2
1 h. The one-twentieth aliquot of the cDNA was subjected to
Plasmid constructs and reagents PCR amplification using gene-specific primers [Table 1]. The
The ×1.3 Cp-luciferase HBV was generously provided by Y. cDNAs were amplified by PCR and the PCR products were
Shaul (Weizmann Institute of Science, Rehovot, Israel). The examined by electrophoresis on 1.2% agarose gel. Real-time
1.2 mer HBV including N-terminal ×3 flagged HBx were kindly PCR was performed with TOPreal qPCR ×2 PreMIX with
provided by W. S. Ryu (Yonsei University, Seoul, South Korea). SYBR green (Enzynomics, Daejeon, South Korea) and each of
™
To construct HBV-Xp-luc and HBV-preS1p-luc, the promoter the primers using StepOne Real-time PCR System (Applied
fragments in HBV genome construct were amplified by Biosystems, Carlsbad, CA, USA). The comparative threshold
polymerase chain reaction (PCR) using cloning primers cycle method (ΔΔC method) was used to calculate the
T
containing restriction enzyme site, HindIII, and KpnI. After relative gene expression levels with human β-actin as an
digestion, the fragments were cloned into pGL4 vectors. The endogenous control gene.
sequences were confirmed by automated DNA sequencing.
Sorafenib was purchased from Selleckchem (Houston, TX, USA). SDS-PAGE and Western blotting
Chenodeoxycholic acid (CDCA) and Z-guggulsterone (Z-GGS) Cells were lysed with lysis buffer containing 150
were purchased from Sigma (St. Louis, MO, USA). SP600125 mmol/L NaCl, 50 mmol/L Tris-Cl (pH 7.5), 1 mmol/L
was purchased from Calbiochem (Billerica, MA, USA). The EDTA, 1% Nonidet P-40, 10% glycerol and protease
transfection reagents PolyFect and jetPEI were purchased
from Qiagen (Hilden, Germany). Table 1: Primers used for PCR amplifi cation
Speices Gene Type Sequence (5’-3’)
Drug and inhibitor treatment HBV HBx Sense ATGGCTGCTAGGCTGTGCTGC
Cells were treated with indicated chemicals or vehicle Anti-sense ACGGTGGTCTCCATGCGACG
controls and incubated for 24 h . Control vehicle HBV core Sense ATGCAACTTTTTCACCTCTGC
treatment (dimethelsulfooxide) was equivalent to the dose Anti-sense CTGAAGGAAAGAAGTCAGAAG
range experiments for each tested drug. Human FXR Sense GCCTGTAACAAAGAAGCCCC
Anti-sense CAGTTAACAAGCATTCAGCAAC
β-actin Sense GACTACCTCATGAAGATC
Luciferase assay Anti-sense GATCCACATCTGCTGGAA
Cells were transfected with both the reporter vector PCR: polymerase chain reaction; HBV: hepatitis B virus; FXR: farnesoid X
and the β-galactosidase expression plasmid along with receptor

98 Hepatoma Research | Volume 1 | Issue 2 | July 15, 2015