Page 343 - Read Online

smaller pieces and fixed with 4% paraformaldehyde in group. The total RNA was extracted from the samples using
0.1 mol/L phosphate buffer. They were then embedded an RNeasy Fibrous Tissue Mini Kit (Qiagen, Düsseldorf,
in paraffin, sectioned and mounted onto slides for Germany). One microgram of total RNA was then reversely
TdT‑mediated dUTP‑X nick end labeling (TUNEL) staining. transcribed into single‑stranded complementary DNA with
a ProtoScript M‑MuLV First Strand cDNA Synthesis Kit
TUNEL staining was performed using an in situ cell (New England Biolabs, Ipswich, MA, USA), according to the
death detection kit (Roche, Basel, Switzerland). After manufacturer’s instructions. The complementary DNA was
being heated to 60 °C and dewaxed, the sections were
rehydrated and then incubated in a 20 µg/mL proteinase K then used for real‑time polymerase chain reaction (PCR).
working solution for 15 min at room temperature. The The process of amplification and quantification were
slides were rinsed (5 min, 3 times) with phosphate‑buffered performed with a real‑time quantitative PCR system
saline (PBS) and then incubated in a TUNEL reaction (Agilent, Santa Clara, CA, USA). β‑actin was used as the
mixture for 1 h at 37 °C. The slides were rinsed internal control. The PCR protocol was as follows: heating
once again and dried. Converter‑POD (anti‑fluorescein for 2 min at 50 °C, initialization at 95 °C for 10 min,
antibody, Fab fragment from sheep, and conjugated with followed by 40 cycles of denaturation at 95 °C for 15 s,
peroxidase (POD)) was added to the samples for 1 h at annealing at 58 °C for 30 s, and extension at 72 °C for
37 °C. The sections were rinsed with PBS and stained 30 s. The primers used in quantitative real‑time PCR were
with 3,3’‑N‑diaminobenzidine tetrahydrochloride. Five Rat Bcl‑2 (forward: 5’‑AGAACCTTGTGTGACAAATGAGAA‑3’
slide fields were randomly examined using a defined and reverse: 5’‑TACCCATTAGACA‑TATCCAGCTTGA‑3’) and
rectangular field area under ×40 magnification. Cells β‑actin (forward: 5’‑GGCGGCCAAACAGAAAG‑3’and reverse:
were then counted under ×400 magnification. The 5’‑CTGAGGGCACGGAGGAT‑3’).
apoptotic index (AI) was represented as the percentage of Statistical analysis
TUNEL‑positive cells versus the total number of cell nuclei In this study, all data are reported as the mean ± standard
per field. error of the mean (SEM). Significant differences were
Caspase‑3 activity assay determined via one‑way analysis of variance. Least significant
Caspase‑3 activity was detected using a Fluorometric Assay difference t‑test was used for between‑group comparisons.
Kit (Biovision Research Products, Mountain View, CA, USA). Statistical significance was set at P < 0.05. All analyses were
Briefly, 50 mg of skin flap tissue was homogenized in ×2 conducted using SPSS 17.0 (SPSS Inc., Chicago).
reaction buffer and incubated for 1 h at 37 °C with
caspase‑3 substrate (DEVD‑APC, 1 mM). Substrate cleavage RESULTS
was measured with a spectrofluorometer at 400 nm.
Skin flap survival
ASK1 and Bcl‑2/Bax Western blot Seventy‑two hours following reperfusion, necrotic skin
Skin flap tissue (100 mg) was sampled from the proximal, flaps were observed and presented as gray areas with
middle and distal regions of the harvested flaps. The samples little elasticity. In contrast, surviving areas maintained
used for detection were randomly selected from all the normal elasticity and skin color [Figure 1a]. The highest
samples in each rat in each group to avoid any deviation skin flap survival percentage was observed in the
caused by using different parts of the skin flap samples. HBO + HRS group (47.70% ± 12.05%). There were
Ninety micrograms of total protein were extracted and significant differences between the IR (23.30 ± 6.49%),
analyzed from each sample. The protein samples were mixed HRS (36.90% ± 7.46%), HBO (39.00% ± 9.14%) and
with loading buffer and boiled at 95 °C for 15 min. The HBO + HRS (47.70% ± 12.05%) groups (values are the
protein samples were then electrophoresed in a 10% dodecyl mean ± SEM, IR vs. HRS, P < 0.01; IR vs. HBO, P < 0.001;
sulfate‑polyacrylamide gel (Bio‑Rad, USA) and transferred onto IR vs. HBO + HRS, P < 0.001). Among the HBO, HRS and
nitrocellulose filter membranes for 1 h at 80 V. The samples HBO + HRS groups there were significant differences
were incubated overnight at 4 °C with goat polyclonal between HBO and HBO + HRS (P < 0.05), and HRS and
actin antibody (1:1,000 dilution, Santa Cruz Biotechnology, HBO + HRS groups (P < 0.05) [Figure 1b].
Inc., USA), pASK1 antibody (1:500 dilution Cell Signaling
Technology, Boston, MA, USA), rabbit anti‑Bcl‑2 polyclonal Skin flap perfusion evaluation
antibody (1:1,000 dilution, Chemicon International, Inc., USA), Seventy‑two hours following reperfusion, skin flap
and rabbit anti‑Bax polyclonal antibody (1:1,000 dilution, perfusion stabilized and was analyzed. Skin flap perfusions
Stressgen Bioreagents, Corp., USA). The proteins were then were 131.10 PU ± 20.14 PU in the sham group,
incubated with horseradish peroxidase‑conjugated secondary 26.10 PU ± 8.09 PU in the IR group, 62.40 PU ± 14.10 PU
antibodies diluted at 1:2,500 for 1 h at 37 °C. The blots in the HBO group, 56.00 PU ± 25.12 PU in the HRS group
were then treated with a chemiluminescence detection and 84.70 PU ± 13.44 PU in the HBO + HRS group.
reagent (Pierce, USA) and exposed to autoradiography film.
The bands were then quantified by densitometry. A significantly higher blood perfusion was measured in
the sham, HBO and HBO + HRS groups. There were
Quantitative real‑time polymerase chain reaction statistical differences between the following groups: IR vs.
for Bcl‑2 messenger RNA HBO, P < 0.001; IR vs. HRS, P < 0.001; IR vs. HBO + HRS,
Skin flap tissue (30 mg) was sampled from the proximal, P < 0.001; HRS vs. HBO + HRS, P < 0.01; and HBO vs.
middle and distal areas of the harvested flaps from each HBO + HRS, P < 0.01 [Figure 1c].

334 Plast Aesthet Res || Vol 2 || Issue 6 || Nov 12, 2015