Page 285 - Read Online
P. 285

Chen et al.                                                                                                                                                                                               Screening of genetic loci

           Table 1: Primer sequences for scanning microsatellite loci on the 17th chromosome of mouse genome
            Loci name                             Primer sequence                          Genetic distance (cM)
            D17MIT245.1          Forward          FAM-TGTGCTCTGGCTAGGGAGTT                         3
                                 Reverse          CACATTCATATGTACACACACATGC
            D17MIT143.2          Forward          FAM-CTTACAAGCATCCTGTGGAACTC                      5
                                 Reverse          GAGGACCAACAGTCAAACATAGC
            D17MIT46             Forward          FAM-TCCACCCCACTACCTGACTC                        11.7
                                 Reverse          CCCTTCTGATGACCACAGGT
            D17MIT146.1          Forward          FAM-CTGTCAGCAGAACGTTCCTTAGT                     17.1
                                 Reverse          CCAACTCAAGCCTTACATAGTGG
            D17MIT51.1           Forward          FAM-TCTGCCCTGTAACAGGAGCT                        22.9
                                 Reverse          CTTCTGGAATCAGAGGATCCC
            D17MIT10.1           Forward          FAM-TGCACTTGCATAAGGAAAAC                        24.5
                                 Reverse          GACTTTGGGGCCTACTTATG
            D17MIT180.1          Forward          FAM-AGACACTGTCTAAAAACACAAGATGG                  29.4
                                 Reverse          TTGTGTTCATATGCATGTGTGC
            D17MIT20.1           Forward          FAM-AGAACAGGACACCGGACATC                        34.3
                                 Reverse          TCATAAGTAGGCACACCAATGC
            D17MIT184            Forward          FAM-TGCACTACCCAAACATGCAT                        38.5
                                 Reverse          ACTTCTGACAGGAAGCATCCA
            D17MIT93.1           Forward          FAM-TGTCCTTCGAGTGTTTGTGTG                       44.5
                                 Reverse          TCCCCGGTGAATGAGTTATC
            D17MIT39.1           Forward          FAM-CCTCTGAGGAGTAACCAAGCC                       45.3
                                 Reverse          CACAGAGTTCTACCTCCAACCC
            D17MIT122.1          Forward          FAM-TCTCTTCACTGCAATGGAACA                       51.9
                                 Reverse          GAACCTATAGGCTCTTGAATAGATGG
           homologous genes that showed some of the following   Down syndrome critical region gene 1-like 1, MSM
           characteristics:  (1) containing many quantitative  trait   lymphoma  resistance 1,  etc.; (5) containing  mouse
           loci, such as epididymal  fat  pad weight quantitative   tissue associated antigen H-2.
           trait loci (QTL) 3, subcutaneous fat pad weight QTL 4,
           spleen weight QTL 9, etc.; (2) containing some genes   DISCUSSION
           related to the important physiological functions of the
           body such as Mut methylmalonyl-Coenzyme A mutase;   It has been widely observed that different species or
           (3) containing genes related to the developmental and   even individuals of the same species show differences
           physiological  function such as early growth adjusted   in response to infection, but the explanation  for this
           QTL 2, early growth QTL 5,  etc.;  (4) containing   phenomenon  is still rather controversial. There have
           genes  associated  with some diseases  such as the
                                                              Table 3: Microsatellite loci scanning using BALB/C and
           Table 2: PCR reaction system and PCR reaction condition  C57BL/6 inbred mice
            PCR reaction system (total volume: 10 uL)          Microsatellite loci  BALB/C         C57BL/6
               Non-enzyme water                    5.4 μL                         susceptible      tolerant
               10 × PCR buffer                     1.0 uL      D17MIT245.1            194            202
                2+
               Mg  (25 mmol/L)                     0.5 uL      D17MIT143.2            112            112
               dNTP (each 2.5 mmol/L)              1.0 μL      D17MIT46               218            236
               P1 (5 pM)                           0.5 uL
               P2 (5 pM)                           0.5 uL      D17MIT146.1            166            166
               Template DNA (30-50 ng/uL)          1.0 uL      D17MIT51.1             152            154
               Ex-Taq enzyme (5 U/μL)              0.1 μL      D17MIT10.1             155            155
            PCR reaction condition                             D17MIT180.1            139            137
               95 ℃                                5 min       D17MIT20.1             163            175
               94 ℃                                30 s
               Time                                30 s        D17MIT184              126            128
               72 ℃                                30 s        D17MIT93.1             155            155
               Repeat the 2nd to 4th steps for totally 38 cycles  D17MIT39.1          86             104
               72 ℃                                10 min
               Store at 4 ℃                                    D17MIT122.1            141            141
           PCR: polymerase chain reaction                     Microsatellite loci with difference were marked in bold
            276                                                              Neuroimmunology and Neuroinflammation ¦ Volume 3 ¦ December 26, 2016
   280   281   282   283   284   285   286   287   288   289   290