Page 81 - Read Online

Page 4 of 7 Sazonova et al. Vessel Plus 2019;3:8 I http://dx.doi.org/10.20517/2574-1209.2019.01

Table 2. Primers for pyrosequencing
Mutation Primer
m.12315G>A TTTGGAGTTGCAC(12328-12316)
m.652delG CCCATAAACAAATA(639-651)
m.3336T>C TGCGATTAGAATGGGTAC(3354-3337)
m.14459G>A GATACTCCTCAATAGCCA(14439-14456)
m.5178C>A ATTAAGGGTGTTAGTCATGT(5200-5181)
m.13513G>A AGGTTTCTACTCCAA(13497-13511)
m.652insG CCCATAAACAAATA(639-651)
m.3256C>T AAGAAGAGGAATTGA(3300-3286)
m.15059G>A TTTCTGAGTAGAGAAATGAT(15080-15061)
m.1555A>G ACGCATTTATATAGAGGA(1537-1554)
m.14846G>A GCGCCAAGGAGTGA(14861-14848)

PCR was conducted using “PTC DNA Engine 200” [13-16,20] .

The DNA amplicons were analyzed on automated pyrosequencing device PSQTMHS96MA (Biotage,
Sweden) [10,11] . Primers for pyrosequencing are listed in Table 2 [13-16,20] .

[26]
For statistical analysis of the obtained results software package SPSS 22.0 was used . Bootstrap analysis was
also conducted. Correlation was considered statistically significant at the level of P ≤ 0.05. The results at the
significance level of P ≤ 0.1 were considered to show a tendency to statistical significance.

RESULTS
The age characteristics for study participants are presented in Table 3. The age of conventionally healthy
participants ranged from 51 to 73 years. In the meantime, the age of patients with cardiac angina ranged
from 52 to 76 years. The average age of conventionally healthy study participants was 2 years less than the
age of patients with cardiac angina. This age difference between samples of patients with cardiac angina and
conventionally healthy participants was not statistically significant.

Demographic characteristics for study participants are presented in Table 4. The data in Table 4 is presented
as an average value with indicating the standard deviation (in parentheses).

According to Table 4, statistically significant differences by clinical and anthropometric characteristics
between samples of patients with cardiac angina and conventionally healthy study participants were not
found.

The aim of the investigation was to analyze the association of 11 mitochondrial genome mutations with
cardiac angina: m.12315G>A, m.652delG, m.5178C>A, m.14459G>A, m.3336T>C, 652insG, m.3256C>T,
m.1555A>G, m.15059G>A, m.13513G>A, m.14846G>A. In our preliminary studies, an association of these
mutations with atherosclerosis, a risk factor for cardiac angina, was identified. Therefore, we decided to
investigate whether these mutations have a link with cardiac angina.

Statistical analysis of the link of these mitochondrial genome mutations with cardiac angina is presented in
Table 5.

As illustrated in Table 5, three mitochondrial mutations of human genome correlated with cardiac angina.
A positive correlation was observed for mutation m.14459G>A (P ≤ 0.05). One single nucleotide substitution
m.5178C>A (P ≤ 0.1) had a trend for positive correlation with this disease. We suppose that in case of