Page 79 - Read Online

van Beek et al. Microbiome Res Rep 2025;4:13 https://dx.doi.org/10.20517/mrr.2024.45 Page 5 of 19

Quantification of total bacteria was carried out by qPCR using a BioRad iCycler iQ thermal cycler system
(BioRad, Hercules, CA) with HOT FIREPol® EvaGreen® qPCR Mix Plus (Solis BioDyne, Tartu, Estonia) as
[12]
explained , 331F (TCCTACGGGAGGCAGCAGT)/797R (GGACTACCAGGGTATCTAATCCTGTT)
primers targeting the 16S rRNA gene and 0.5 ng of faecal DNA. Briefly, the thermal cycling conditions
started with a DNA-denaturation step at 95 °C for 15 min, followed by 40 cycles of (1) denaturation at 95 °C
for 15 s; (2) annealing at a primer-specific temperature for 20 s; (3) extension at 72 °C for 30 s; and (4) an
incubation step to detect the fluorescent data. A melting curve analysis was carried out to ensure the
2
specificity of the amplification products. The 10-log-fold standard curves ranging from 10 to 10 copies
7
were produced using the full-length amplicons of the 16S rRNA gene of Bifidobacterium longum to convert
the threshold cycle (Ct) values into the average estimates of genomes present in 1 g of faeces (copy
[26]
numbers/g of wet faeces) in each assay .
Metagenomic sequencing

Sequencing libraries were prepared using the Illumina Nextera DNA Flex kit, according to the
manufacturer’s instructions. Shotgun metagenomic sequencing of 2 × 150 bp was performed with an
Illumina NovaSeq system using S4 flow cells with a lane divider (Illumina, San Diego, CA, United States) at
the sequencing laboratory of the Institute for Molecular Medicine Finland (FIMM), University of Helsinki.

Taxonomic annotation
Raw reads were filtered using fastp , with parameters Q < 20, min read length > 50, reads merged with a
[27]
minimum of 15 bp overlap, reads with Ns discarded, and 3 bp trimmed from the front and back of the
reads. To remove host DNA, filtered reads were mapped using Minimap2 (Li, 2021) and SAMtools [28]
against the human genome (GRCh38.p14, NCBI RefSeq assembly: GCF_000001405.40). Taxonomic
annotation was performed by mapping the filtered reads using Mininimap2 against the HumGutDB .
[29]
Relative abundances were summarized at different taxonomic levels in R and translated into absolute
abundances by multiplying with the total number of bacterial genomes.

Bristol score
Bristol score was determined visually from faecal samples upon retrieval from -20 °C storage.

Faecal water extraction from faecal samples
Approximately 100 mg aliquots of the frozen faecal samples were taken and suspended into 0.5 mM
solution of PMSF protease inhibitor (Thermo Scientific, 36978) in 1× PBS (VingLab) in a 1:10 ratio. The
median pH was 6.97 (interquartile range 6.47-7.28). Samples were kept on ice. Samples were centrifuged
twice for 15 min, at +4 °C at 13,000 rpm. Sample supernatants were distributed to 96-well plates for storage
at -80 °C and further analysis.

Biomarker quantification
All absorbances were read with Hidex Sense microplate reader.

Total protein levels
Total protein concentrations were measured using a DC Protein Assay Reagents Package (5000116, Bio-
Rad) according to the manufacturer’s protocol, with bovine serum albumin lyophilized (Biowest, P6154) as
standard. A linear standard curve was used for the calculation of the results.

Albumin - Alb
Albumin was quantified with sandwich ELISA using Human Albumin Matched Antibody Pair Kit (Abcam,
ab246841) according to the manufacturer’s general protocol for matching antibody pair kits. A four-