Page 119 - Read Online

Page 4 of 19 Wang et al. Microbiome Res Rep. 2025;4:23 https://dx.doi.org/10.20517/mrr.2024.94

Spike-in bacteria and quantification
In this study, we utilized Planococcus sp. APC 3900 (NCBI: txid3035191) and Pseudoalteromonas sp. APC
[23]
3896 (NCBI: txid3035187), isolated from the skin of deep-sea fish, as previously described . These marine
bacteria, belonging to the Pseudomonadota and Bacillota phyla, respectively, are typically absent from
mammalian fecal microbiomes under normal physiological conditions. They are easily distinguishable from
bacteria commonly found in the gut using 16S rRNA gene sequencing [24,25] . These strains are effectively
amplified by standard V3-V4 16S rRNA primers, enabling their quantification during sequencing. While
16S rRNA sequencing typically resolves taxa at the genus level, the absence of Pseudoalteromonas and
Planococcus genera in human gut microbiomes allows genus-level abundance to reliably represent these
spike-in strains. The strains were cultured in DifcoTM 2216 marine broth (BD DifcoTM, New Jersey, USA)
and incubated aerobically with agitation at 30 °C for 24 h. Pseudoalteromonas sp. APC 3896 is a gram-
negative bacterium, whereas Planococcus sp. APC 3900 is a gram-positive bacterium. The 16S rRNA gene
[26]
copy numbers per genome for the spike-in bacteria were obtained from the rrnDB database . The copy

numbers of the spike-in bacteria were calculated using the formula: number of copies (molecules) =
9
(amount of DNA ng × 6.022 × 10 molecules/mole) / (length of dsDNA amplicon × 660 g/mole × 1 × 10 ng/
23
g).
DNA extraction
Genomic DNA was extracted from the mother and infant samples using the QIAmp Mini stool DNA
extraction kit (Qiagen, USA), following the manufacturer’s instructions with slight modifications, as
recommended in prior studies . Approximately 0.2 g of stool sample was transferred into a tube
[27]
containing around 50 mg of pre-sterilized zirconia beads of various sizes (Biospec, USA), followed by the
addition of 1ml of lysis buffer. The mixture was then subjected to bead beating for homogenization, and
nucleic acid extraction was performed according to the manufacturer’s instructions. The concentration of
sample DNA and spike-in DNA was measured using the Qubit 1X dsDNA High Sensitivity (HS) assay kit
TM
and Qubit 4 (Invitrogen, USA).

qPCR assessment of bacterial loads
DNA extracted from fecal samples served as a template for qPCR amplification of bacterial 16S rRNA genes
[28]
using the primer pair U16SRT-F (ACTCCTACGGGAGGCAGCAGT) and U16SRT-R
(TATTACCGCGGCTGCTGGC) on an Applied Biosystems 7500 Fast Real-Time PCR System (Thermo
Fisher Scientific). Another primer pair F-bifido (CGCGTCYGGTGTGAAAG) and R-bifido
(CCCCACATCCAGCATCCA) specific for the genus Bifidobacterium was also used . PCR assays were
[29]
prepared with 10 μL PowerUp SYBR Green Master Mix (Thermo Fisher Scientific), 0.8 μL of each primer
solution (10 μm), 7.4 μL of sterile nuclease-free water, and 1 μL of template DNA solution. The
amplification program included initial denaturation at 95 °C for 180 s, followed by 40 cycles of denaturation
at 95 °C for 10 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s. Each run included negative
controls (without DNA), extraction controls (without pellet), and positive controls (with genomic DNA
from Pseudoalteromonas sp. APC 3896 and Planococcus sp. APC 3900). A melting curve analysis was
conducted after each run, and cycle threshold values were determined using 7500 software v2.0.6 (Thermo
Fisher Scientific). All qPCR assays were performed in triplicate. The standard curve was employed to
convert the Ct values obtained from the qPCR run into absolute copy numbers. This curve establishes a
linear relationship between Ct values and the logarithm of the initial DNA concentration. By correlating the
Ct values of the samples with the standard curve, the total copy number of the DNA in each stool sample
can be accurately determined.