Page 26 - Read Online

Page 4 of 12 Horie et al. Microbiome Res Rep 2024;3:35 https://dx.doi.org/10.20517/mrr.2024.08

METHODS
Isolation of lactic acid bacteria from animal feces
Animal feces were provided by the Tobe Zoological Park of Ehime Prefecture (Tobe, Ehime, Japan) and the
New Yashima Aquarium (Takamatsu, Kagawa, Japan). Fresh feces that were excreted within 2 days were
collected and maintained in chilled storage before isolation. The feces were transferred to sterilized 50-mL
centrifuge tubes and mixed with Mitsuoka’s diluted solution (4.5 g of KH PO , 6.0 g of Na HPO , 0.5 g of
4
2
2
4
L-cysteine hydrochloride, 0.5 g of Tween 80, 1.0 g of agar per 1.0 L of distilled water) at a concentration of
[41]
0.1 g/mL. The feces were suspended by vortexing. The suspension was diluted serially 103 times with PBS
and spread on De Man, Rogosa, and Sharpe (MRS; Merck KGaA, Darmstadt, Germany) or Lactobacillus
Selection (LBS; Becton, Dickinson and Company, Franklin Lakes, NJ, USA) agar plates. The plates were
incubated at 37 °C for 2 days under anaerobic conditions in an AnaeroPack anaerobic gas chamber
(Mitsubishi Gas Chemical Co., Inc., Tokyo, Japan). Single isolated colonies were picked, and individual
colonies were inoculated into screw-top test tubes containing 10 mL of MRS broth. Each isolate was
incubated at 37 °C for 1-2 days. Stock cultures were stored at 80 °C in MRS broth containing 30% glycerol.

Identification of lactic acid bacteria
The isolates were identified by homology analysis of 16S rRNA gene sequences. They were cultured
overnight in MRS broth and collected by centrifugation at 10,000 × g for 10 min. Each pellet was
resuspended in elution buffer, and the bacterial cells were lysed by sonication using a Bioruptor (Sonicbio
Co. Ltd., Samukawa, Japan). DNA was extracted from the isolates using a DNeasy Blood & Tissue Kit
(Qiagen, Hilden, Germany). Polymerase chain reaction (PCR) amplification was performed on an Applied
Biosystems Veriti Thermal Cycler (Thermo Fisher Scientific Inc., Waltham, MA, USA) with a set of
bacterial universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG‐3’) and 1492R (5’-
GGTTACCTTGTTACGACTT‐3’) or 10F (5’-GTTTGATCCTGGCTCA‐3’) and 800R (5’-
[42]
TACCAGGGTATCTAATCC‐3’) with Takara Ex Taq DNA polymerase (Takara Bio Inc., Kusatsu, Japan).
The PCR cycles were conducted with a 50-μL reaction mixture containing 1 μL of template DNA, 1 μmol/L
primers, 1.25 U of Ex Taq polymerase, 5 μL of PCR buffer, and 0.2 mmol/L of each deoxynucleotide
triphosphate. All primers were synthesized by Eurofins Genomics (Tokyo, Japan). The following thermal
cycling conditions were used: initial denaturation for 3 min at 95 °C; 40 cycles of 30 s at 95 °C, 55 s at 55 °C,
and 1 min at 72 °C; and a final extension for 10 min at 72 °C. The PCR products were analyzed via
electrophoresis in a 1% agarose gel and then stained with ethidium bromide. The primer sequences used for
DNA sequencing were as follows: LAB-seqF (5’‐TCCTGGCTCAGGACGAACGCT‐3’) or 10F. Sequencing
was performed by Macrogen Japan Corp. (Tokyo, Japan). Sequence identification was performed using the
Standard Nucleotide BLAST of the National Center for Biotechnology Information (http://blast.ncbi.nlm.
nih.gov/Blast.cgi).

Evaluation of sugar utilization by lactic acid bacteria
Sugar utilization by the isolates was examined using the API 50 CH system (bioMérieux, Inc., Marcy-
I’Etoile, France). The isolates were preincubated in MRS broth overnight and collected by centrifugation at
5,400 × g for 10 min. After the bacteria were washed once with PBS, each pellet was resuspended in API 50
CHL medium (bioMérieux) at McFarland Standard No. 2. Each suspension was inoculated in a test tube
containing API 50 CH and covered with mineral oil. The bacteria were then cultured for 48 h at 37 °C.
Sugar utilization was determined by examining the color of the medium.