Page 32 - Read Online

Millen et al. Microbiome Res Rep 2023;2:26 https://dx.doi.org/10.20517/mrr.2023.29 Page 5 of 14

annotated using RAST or PATRIC RASTtk-enabled Genome Annotation Service [29-31] . Sequences were
analyzed using Geneious Prime 2021.0.3 (https://www.geneious.com). Protein analysis was performed using
HHpred (Homology detection & structure prediction by HMM-HMM comparison) [32,33] .

Table 2. Primer sequences and thermocycler conditions
Primer name Sequence (5’ - 3’) Thermocycler conditions
Clone 6073DIT-F TTCTGGAATGGGATTCAGGACCTAGGGAGGGCTTAATGG Annealing temperature: 57 °C/extension time: 45 s
Clone 6073DIT-R ATCCGTGTCGTTCTGTCCACCATTAAACGAAGTCCGCCTTTC
VF-pG9 GTGGACAGAACGACACGGAT Annealing temperature: 55 °C/extension time: 1 min 45 s
VR-pG9 TCCTGAATCCCATTCCAGAA
CheckDIT-F CTAGCGGTTACGGTTTAAGC Annealing temperature: 53 °C/extension time: 1.5 min
CheckDIT-R CCCAYARTTCATARTTAATRAC
p2RPB-F TGTTAGAGCTATCAATTACTG Annealing temperature: 53 °C/extension time: 30 s
p2RPB-R CCATGTTGCGAA AAGAATCG

Molecular cloning and phage engineering
Development of pG9Dit was performed using NEBuilder® HiFi DNA Assembly (New England Biolabs,
6887
USA). PCR amplification of dit was conducted from D6887 phage lysate with primers clone 6073DIT-F and
clone 6073DIT-R [Table 2]. A linear amplicon of pGhost9, a vector commonly used for cloning
experiments, was created by PCR with primers VF-pG9 and VR-pG9 [Table 2]. Purified Dit amplicon was
assembled with purified linear pGhost9 using NEBuilder® HiFi DNA Assembly Master Mix (New England
Biolabs, USA) according to the manufacturer’s instructions. Assembly was electroporated into E. coli TG1
[34]
RepA cells according to the Dower method . Recombinant plasmids were isolated from TG1 RepA cells
+
+
using GeneJET Plasmid Miniprep Kit (Thermo Scientific, USA). Purified plasmid was electroporated into
lactococci as previously described .
[35]
To isolate recombinant phages that have exchanged the wild-type dit for dit , phages were propagated on
6887
their respective lactococcal host containing pG9Dit . With sufficient DNA homology between the
6887
respective 5’ and 3’ ends of the wild-type dits and dit , recombination between the phages and pG9Dit
6887
6887
would occur via double crossover [Supplementary Figure 1]. Selection of recombinant phages was
performed by plating the propagations on the respective host + pEPS6073.
Molecular modeling
Molecular modeling of Dit proteins was conducted using the AlphaFold package in monomer mode and
employing the fully compiled database of Protein Data Bank (PDB) structures . Predictions were scored
[36]
based on the pLDDT criteria in order to choose the top-ranked model. Putative carbohydrate-binding
domains were predicted using an in-house software package. Structural alignments were carried out using
the TM-align algorithm . Visualization of models and preparation of publication-grade figures was
[37]
conducted within Pymol .
[38]
Statistical analysis
One-tailed t-tests were conducted for the comparison of adsorption data across recombinant and native
phages on the relevant strains. This was carried out using the SciPy package within Python.