Page 38 - Read Online

Alekseeva et al. Microbiome Res Rep 2023;2:10 https://dx.doi.org/10.20517/mrr.2023.06 Page 5 of 15

the main object of molecular genetic research in our laboratory. It is also a component of the probiotic
preparation “Genobact”. The strain B. longum subsp. longum GT15 was cultivated anaerobically
(HiAnaerobic SystemeMark III, HiMedia, India) in agar and MRS broth (HiMedia, India) supplemented
[31]
with cysteine (0.5 g/L) at 37 °C for 24-48 h. E. coli strains were cultivated in Luria-Bertani (LB) broth .
Ampicillin (150 μg/mL) was used as a selective marker for cells containing plasmids.

DNA manipulations
The genomic DNA of B. longum subsp. longum GT15 was isolated using the GenElute Bacterial Genomic
DNA Kit (Sigma-Aldrich, USA). Isolation of plasmid DNA, obtaining competent E. coli cells,
transformation and analysis of recombinant plasmids were performed using standard methods .
[31]

Fragments of the fn3 gene encoding the 2 FN3 domains and encoding the C-terminal region were amplified
from the strain B. longum subsp. longum GT15 genomic DNA using the Phusion High-Fidelity PCR Master
Mix kit (Thermo Fisher Scientific, Lithuania) on a PTC-0150 MiniCycler (MJ Research, Inc., USA). A
fragment of the fn3 gene reaching 537 bp in length encoding two domains of the FN3 domain (stretching
from nucleotide 4,480 to nucleotide 5,013) was amplified using the oligonucleotides FN3-N
5´
3´
3´
( tcgtcatatgcccgagccgccactgctc ) and FN3-CD ( gatcctcgagctaggactcggcactccaattga ). The fragment
5´
encoding the C-terminal region (stretching from nucleotide 5014 to nucleotide 5985; overall fragment size
3´
5´
including the stop codon = 972 bp) was amplified using FN3-CN ( tcgtcatatggccgcatcgccgtcagaga ) and
FN3-C ( gatcctcgagctactgcttgtgaatggtggt ) oligonucleotides. The resulting fragments were cloned between
3´
5´
the NdeI and XhoI restriction sites in the pET16b expression vector containing His-Tag for protein isolation
and purification. The sequences of all cloned fragments were confirmed by the sequencing of the
corresponding plasmid DNA.
Expression of the cloned genes in E. coli and purification of recombinant 2D FN3 and CD FN3
proteins
E. coli BL21(DE3) cells harboring recombinant plasmids containing the cloned genes were first grown in LB
broth at 37 °C to an optical density of 0.6-0.8 (~2 h). Gene expression was induced by adding 1.0 mM
isopropyl-β-D-thiogalactoside (IPTG). Next, the cells were cultured at 25 °C for 18 h, after which they were
pelleted by centrifugation (5,000 rpm, 10 min, 4 °C) and stored at -20 °C. To study the expression of the
cloned genes, cells were suspended in sample buffer (pH 6.8) containing 62.5 mM Tris-HCl, 5% glycerol, 2%
2-mercaptoethanol, 0.1% SDS, 0.001% and bromophenol blue. Then, the cells were lysed by heating them to
95 °C for 10 min and were analyzed using SDS-PAGE afterwards. E. coli BL21(DE3) protein fractions
containing the pET16b plasmid without an insert were used as a negative control.

Protein isolation and purification was carried out following the method described by us earlier . For
[24]
further protein purification, dialysis was employed in PBS buffer containing 10% glycerol and 1 mM PMSF.
The concentration of the isolated protein was measured on a Qubit 2.0 fluorometer (Invitrogen, USA).
Purified proteins were stored at -80 °C.

Assessment of the ability of FN3 protein fragments to bind to human TNFα
In our study, we used polyclonal rabbit IgG antibodies specific to the FN3 protein. The techniques of
production, extraction and purification of antibodies were described by us earlier . In the devised ELISA
[24]
test described previously , anti-FN3 antibodies were used as a “trap” for the FN3 protein. The polyclonal
[24]
nature of these antibodies allowed us to assume that they also cross-react with 2D FN3 and CD FN3
fragments, which was verified from the outset of the study.